Review



plko 1 blast  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 blast
    Plko 1 Blast, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 blast/product/Addgene inc
    Average 94 stars, based on 134 article reviews
    plko 1 blast - by Bioz Stars, 2026-06
    94/100 stars

    Images



    Similar Products

    plko 1 blast  (Addgene inc)
    94
    Addgene inc plko 1 blast
    Plko 1 Blast, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 blast/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    plko 1 blast - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    paper n a plko 1 blast addgene  (Addgene inc)
    98
    Addgene inc paper n a plko 1 blast addgene
    Paper N A Plko 1 Blast Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paper n a plko 1 blast addgene/product/Addgene inc
    Average 98 stars, based on 1 article reviews
    paper n a plko 1 blast addgene - by Bioz Stars, 2026-06
    98/100 stars
    		  Buy from Supplier
    plko 1 blast vector  (Addgene inc)
    94
    Addgene inc plko 1 blast vector
    Plko 1 Blast Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 blast vector/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    plko 1 blast vector - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    plko 1 blast scramble cctaaggttaagtcgccctcg  (Addgene inc)
    94
    Addgene inc plko 1 blast scramble cctaaggttaagtcgccctcg
    Plko 1 Blast Scramble Cctaaggttaagtcgccctcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 blast scramble cctaaggttaagtcgccctcg/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    plko 1 blast scramble cctaaggttaagtcgccctcg - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    plko 1 blast trna leu cag  (Addgene inc)
    94
    Addgene inc plko 1 blast trna leu cag
    Plko 1 Blast Trna Leu Cag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 blast trna leu cag/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    plko 1 blast trna leu cag - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier

    Image Search Results